Influence pH on virulence genes of Pseudomonas aeruginosa analyzed by RT-PCR method

Ahmed Attalah Hassan Al-Fhdawi (Department of Biology, College of Science, University of Baghdad Al-Jaderyia Campus, Baghdad, Iraq)
Adel Mashaan Rabee (Department of Biology, College of Science, University of Baghdad Al-Jaderyia Campus, Baghdad, Iraq)

Arab Gulf Journal of Scientific Research

ISSN: 1985-9899

Article publication date: 23 March 2023

Issue publication date: 26 March 2024

697

Abstract

Purpose

The purpose of this study was to determine the influence of environmental pH on production of biofilms and virulence genes expression in Pseudomonas aeruginosa.

Design/methodology/approach

Among 303 clinical and environmental samples 109 (61 + 48) isolates were identified as clinical and environmental P. aeruginosa isolates, respectively. Clinical samples were obtained from patients in the Al-Yarmouk hospital in Baghdad city, Iraq. Waste water from Al-Yarmouk hospital was used from site before treatment unit to collect environmental samples. The ability of producing biofilm at various pH levels was examined by microtiter plate and the prevalence of Alg D, Psl A and Pel A was determined by quantitative real time-polymerase chain reaction (qRT-PCR).

Findings

This study showed that the ability of clinical and environmental isolates to biofilm development was observed in 86.9% and 85.42% of clinical and environmental isolates, respectively. As well as, the environmental P. aeruginosa isolates showed the highest biofilm production at pH 7. Clinical isolates showed the highest genes expression of Alg D, Psl A and Pel A as compared to environmental isolates with pH change. In general, both clinical and environmental isolates formed biofilm and carried AlgD, PslA and PelA genes. Also, alkaline pH was favored for biofilm production.

Originality/value

There are very few studies done to find out the influence of environmental pH on production of biofilms and virulence genes expression in Pseudomonas aeruginosa. This study is unique as it has highlighted the influence of environmental pH on the ability of clinical and environmental isolates to biofilm development and genes expression.

Keywords

Citation

Hassan Al-Fhdawi, A.A. and Rabee, A.M. (2024), "Influence pH on virulence genes of Pseudomonas aeruginosa analyzed by RT-PCR method", Arab Gulf Journal of Scientific Research, Vol. 42 No. 2, pp. 280-289. https://doi.org/10.1108/AGJSR-10-2022-0244

Publisher

:

Emerald Publishing Limited

Copyright © 2023, Ahmed Attalah Hassan Al-Fhdawi and Adel Mashaan Rabee

License

Published in Arab Gulf Journal of Scientific Research. Published by Emerald Publishing Limited. This article is published under the Creative Commons Attribution (CC BY 4.0) licence. Anyone may reproduce, distribute, translate and create derivative works of this article (for both commercial and non-commercial purposes), subject to full attribution to the original publication and authors. The full terms of this licence may be seen at http://creativecommons.org/licences/by/4.0/legalcode


Introduction

The known superbug Pseudomonas aeruginosa is opportunistic, produces numerous nosocomial infections, including wound, urinary, respiratory and other infections. It may result in both acute and recurrent infections. P. aeruginosa is a key contributor to deadly severe respiratory infections. P. aeruginosa is responsible for about 10% of all nosocomial bacterial infections, and as a result, 25–60% of patients pass away (Kumar, Paliya, & Singh, 2022). In terms of antibiotic resistance, the genus Pseudomonas is diverse and one of the most virulent pathogens (Ahmed, Aljondi, Alabed, Al-Mahdi, & Abdsalam, 2021). In roughly 65% of infections, bacteria develop as biofilms, which attach to and spread across the surface of plants (roots) or animals (epithelium). Under conditions of infection, during the development phase, bacteria become 10 to 1000 times more resistant to antibiotics (Abd El-Aleam, George, Georgey, & Abdel-Rahman, 2021). Like many gram-negative bacteria, P. aeruginosa uses N-acyl homoserine lactones (AHLs) signal molecules to keep track of the density of its own population. AHLs interact with cellular receptors by a process known as quorum sensing (QS) at a specific population size, which triggers the activation of numerous target genes, including virulence-related genes, antibiotic formulation, development of biofilms, bioluminescence, motility and swarming (Singh et al., 2009).

The capacity of P. aeruginosa to produce biofilms is crucial for the pathogenesis of many illnesses (Maurice, Bedi, & Sadikot, 2018). It is genetically capable of synthesizing three exopolysaccharides: pellicle exopolysaccharide (Pel), Alginate and polysaccharide synthesis locus (Psl) (Cho, Kwon, Kim, Park, & Koo, 2018). The exopolysaccharides Psl, Pel and alginate are significant elements of the P. aeruginosa biofilm matrix involved in surfaces adhesion in addition to extracellular DNA (eDNA) (Strempel et al., 2013). The genetic make-up of P. aeruginosa isolates, environmental factors and interactions between the two can all have an impact on biofilm production (Maurice et al., 2018). Environmental responses affect virulence as well as growth and survival. The processes by which bacteria respond to stress during biofilm formation are not entirely known. By studying the changes in gene and protein expression during biofilm formation, numerous research have investigated the bacterial stress response (Roy et al., 2021). Two polysaccharides, Psl and Pel, are major components of both the sensitive strain and the multidrug-resistant strain's biofilms and are crucial in preventing antibiotics from penetrating drug-resistant cells. Therefore, the impact of pH on the biofilm polysaccharide's synthesis corresponds to the impact of pH on biofilms (Yu, Luo, Liu, & Lin, 2019). Thus, the production of biofilms can be significantly influenced by the pH of the environment. It has been demonstrated that this component affects microbial adherence to surfaces, which is the initial stage in the formation of biofilms (Alotaibi & Bukhari, 2021). Variations in the pH of the environment can affect the bacteria. However, many bacteria regulate their activity through cellular processes like proton translocation and amino acid breakdown to resist these pH variations (Rasamiravaka, Quentin, Pierre, & El Jaziri, 2015). The best pH for secreting polysaccharides differs according to the species, however for most bacteria, it is around pH7 (Tilahun, Haddis, Teshale, & Hadush, 2016). Exopolysaccharide production helps biofilms withstand environmental stresses like pH. So, compared to free-floating cells, more pH-resistant bacteria can be found in the biofilm. For example, under extremely acidic conditions, the gel-like bacterial biofilm's composition could inhibit the rapid transport of ions and allow the development of a pH gradient within the extracellular matrix. However, due to the disruption of biofilm formation in alkaline environments, poorly organized and extremely thin biofilms develop (Alotaibi & Bukhari, 2021). It is important to explore whether a change in environmental pH has any effect on biofilm production and virulence gene expression. Therefore, this study was conducted on clinical and environmental isolates to find out the effect and which of the isolates were more affected by change in pH.

Materials and methods

Bacterial isolated and identification test

The project was approved by the local ethical committee (Ref: CSEC (College of Science Ethics Committee)/0222/0074 in 25 February 2022) in College of Science/Baghdad University.

Previously, from 303 clinical and environmental samples 109 (61 + 48) isolates were diagnosed as clinical and environmental Pseudomonas aeruginosa isolates, respectively, where isolates were grown in various enrichment, differential and selective media, colony morphology, gram-stained cells and a variety of biochemical analyses. Clinical samples were obtained from patients who were being sent to the Al-Yarmouk Hospital in Baghdad, Iraq, during (September 2021–February 2022). Waste water from Al-Yarmouk Hospital was used from site before treatment unit to collect environmental samples as described by Ell-Amin, Sulieman, and El-Khalifa (2012).

Biofilm formation assay

To determine the effect of different pH at 5, 7 and 9 on bacteria ability to biofilm formation, firstly: liquid culture media: Prior to autoclaving, tryptic soy broth with 0.25% glucose was adjusted to the required pH 5 and 9 using 1 M of NaoH and HCl. The culture pH was measured using a standard pH electrode (CRISON). Cells were cultured aerobically and incubated at 37 °C for 24 h (Sánchez-Clemente et al., 2018). Secondly, by using a microtiter plate biofilm formation assay, the P. aeruginosa isolates were examined for their ability to generate biofilm as described by Bahador et al. (2019). Using the same medium as the diluent to McFarland standard No. 0.5, broth cultures were tested. Three wells of a 96-well flat-bottomed polystyrene plate were transplanted with around 125 μL of an isolate suspension each, and they were incubated for 24 h at 37 °C. With 300 μL of distilled water, the wells were washed three times and dried inverted at room temperature, and then stained for 10 to 15 min with 125 μL of a 0.1% crystal violet solution in water. Distilled water was used to gently cleanse the wells three time. On their side, the wells were dried at room temperature, followed by 125 of water with a 0.1% crystal violet solution for about 10–15 min. Crystal violet was thrown out, and to get rid of the wells received an additional crystal violet washes three times. Finally, the addition of crystal violet was released by adding 125 μL (30%) acetic acid. A new, sterilized plate was filled with 125 μL distaining solutions in every well. To measure the absorbance of the de-staining solution, an ELISA (enzyme-linked immunosorbent assay) reader (Stat Fax-2100), was used and the absorbance was determined at 490 nm. Each test was carried out three times. The background optical density (OD) was calculated using the un-inoculated media as a control. Three standard deviations more than the mean OD of the negative control were designated as the cutoff OD (ODc). According to the readings of the microtiter plate, the isolates were divided into four categories: strong biofilm producers (4*ODc < ODi), moderate biofilm producers (2*ODc < ODi < 4*ODc), weak biofilm producers (ODc < ODi < 2*ODc), or nonproducers of biofilm (ODi < ODc).

Expression of genes

Four clinical and environmental isolates were employed in this investigation to examine the expression of the pslA, pelA and algD genes, with the 16S rRNA gene serving as a housekeeping or reference gene.

A- RNA Extraction

Utilizing Trizol Reagent as directed by the manufacturer (Promega, US), ribonucleic acid (RNA) was extracted from planktonic P. aeruginosa cells. Bacterial cells were collected in a microcentrifuge tube by centrifugation for 1 min at 13,000 rpm, followed by a series of centrifugations until a large enough amount of pellet was produced. The nucleoproteins complex was completely dissociated by incubating the pellet in 0.5 mL of Trizol for five minutes. Then, 0.15 mL of chloroform was added, utilized for lysis and incubated for 2–3 min. The sample was centrifuged at 12,000 g for 15 min to separate the combination into a colorless upper aqueous phase and a lower red phenol-chloroform phase. The aqueous phase containing the RNA transferred to a new tube and RNA was precipitated by adding 0.45 mL of isopropanol to the aqueous phase following a 10 min incubation period and 10 min at 12,000 g centrifugation, total RNA precipitate produces a white pellet that resembles a gel at the bottom of the tube. The supernatant was discarded by micropipette and resuspended by 0.75 mL of 75% ethanol. Then the vortex used to dissolve the pellet and centrifuge for 5 min at 7500 × g and the supernatant was discarded by micropipette. To dry the RNA pellet the tube opened for 15 min and the pellet resuspended by 20 ul of RNase- Free water and incubated at 60 °C for 15 min by using thermomixer. Total RNA samples stored at 20 °C until processed to downstream application.

B-RNA quantitation by Qubit 4.0

This assay was used to determine RNA purity and concentration, using the Qubit™ RNA HS (high sensitivity) assay kit (Q32852).

C- reverse transcription reaction

By using a protoscript complementary DNA (cDNA) synthesis kit (NEB (new england biolabS (company)), UK), total cell RNA was converted to cDNA as the first step in the analysis of gene expression. The cDNA synthesis was performed by adding 5 μL from each extracted total cell RNA into a new polymerase chain reaction (PCR) tube. Then, 10 μL of protoscript reaction mix (containing dNTPs, buffer and other essential components) was added to each sample. After that, 2 μL of MuLV enzyme and 2 μL of oligo dT were added into each sample. Finally, the total volume was completed up to 20 μL by adding 1 μL of nuclease-free water. The program presented in Table 1 was followed. When conducting the second phase (relative quantitative PCR), the quantification of the cDNA product was also carried out using Qubit 4.0.

D- quantitative real-time PCR(qRT-PCR)

To examine gene expression, quantitative real time-polymerase chain reaction (qRT-PCR) was employed using bioer-Germany. The cDNA samples from clinical and environmental P. aeruginosa isolates were used. There were four PCR tubes per sample, one for each of the four genes (algD, pelA, pslA and 16S rRNA), with the last tube serving as the study's housekeeping gene, quantity detection using the SyberGreen technology. Table 2 lists the primers and their sequences used in the present study. Table 3 shows the qRT-PCT reaction mixture components with their amounts.

The PCR tubes were spun at 2,000 ×g for 1 min before beginning the qRT-PCR in order to get rid of any air bubbles. The same PCR run was conducted using the cDNA samples from clinical and environmental isolates. Table 4 shows the qRT-PCR program.

E- Calculating gene expression

Analysis of the qRT-PCR findings was done using the Livak and Schmittgen formula. Between the treated groups and the calibrators of each gene, the cycle thresholds (ΔCt) and fold changes were assessed (Livak & Schmittgen, 2001). These values were normalized to 16SrRNA expression, as shown below:

  • ΔΔCt = ΔCt (test samples)−ΔCt (calibrator samples)

  • ΔCt (test samples) = Ct (target gene in test)−ΔCt (reference genes in test)

  • ΔCt (calibrator samples) = Ct (target gene in calibrator)−ΔCt (reference genes in calibrator)

  • Fold changes = 2-ΔΔCt

Statistical analysis

The statistical package for social science (SPSS) 2018 was used to analyze the effects of variables in this study. Count and percentage were used to construct categorical data. T-test was utilized to assess the impact of pH on biofilm (SAS, 2018).

Results and discussion

Biofilm forming ability

The ability of P. aeruginosa to produce biofilm was examined in the current study, summarized in Table 5. Results showed from 61 clinical isolates, belonged to P. aeruginosa, 53 (86.9%) was biofilm producers, distributed into 25 (47.2%) were strong biofilm producers, 13 (24.5%) moderate biofilm producers and 15 (28.3%) were weak biofilm producers, and the non -biofilm producers was 8 (13.11%). On the other hand, the present findings indicate of the 48 P. aeruginosa belong to the environmental isolates 41 (85.42%) were identified as a biofilm producers 13 (31.71) possessed strong biofilm-forming ability, 11 (26.83%) formed moderate ability and 17 (41.46) exhibited weak ability, and the nonbiofilm producers were 7 (14.58%) Table 5.

Distribution of clinical and environmental Pseudomonas aeruginosa isolates with their ability to produce biofilm.

According to the results of the current investigation, 94 (86.2%) of clinical and environmental isolates can produce biofilm, which is agreed with the findings of earlier studies 93.6-88.3% of biofilm positive isolates (Karami, Mohajeri, Yousefi, & Karami, 2019; Obaid, 2021).

The influence of pH on biofilm production

Isolates were chosen from each bacterium that forms biofilms in both clinical and environmental isolates in order to assess the influence of pH on biofilm production. The results of the present study summarized in Table 6. Statistical analysis showed a significant difference between clinical and environmental P. aeruginosa isolates (p ≤ 0.05). Also, environmental isolates showed the highest biofilm production at control pH (7).

The current findings are consistent with a prior study that refer to P. aeruginosa biofilm production is influenced by the pH media, higher pH leading to more biofilm production, which were 139–244% at pH 8.5, 136–164% at pH 7.5 in comparison with pH 5.5 (Hostacká, Ciznár, & Stefkovicová, 2010). A similar behavior was described by Wu et al. (2020) that found biofilm forming ability of P. aeruginosa under different pH levels, with alkaline pH being preferred for the development of biofilms. Also, Thomas (2019) study examined how pH affected P. fluorescens growth and antibiotic resistance. The findings show that at a pH of 7, P. fluorescens thrives best, traditional broad-spectrum antibiotics are likewise most effective against it, add to that antibiotics had varying levels of resistance but was equivalent at pH values of 6 and 6.5. The present study is not consistent with the findings obtained by Lin et al. (2021) that revealed P. aeruginosa typically produces more biofilm and accelerates the onset of antibiotic resistance in acidic settings, and that this may be reversed by restoring the acidic environment to physiologically neutral conditions. Another study that dealt with the effect of some biofilm formation inhibitors was study that conducted by Singh et al. (2015) that shown the effect of mycofabricated Silver nanoparticles (mfAgNPs) on biofilm formation of P. aeruginosa, and the results revealed that mfAgNPs inhibited biofilm formation. Also, Singh et al. (2012) found the effect of lagerstroemia speciosa fruit extract (LSFE) on biofilm formation in P. aeruginosa.

Gene expression

In order to determine influence of pH on P. aeruginosa virulence genes pslA, pelA and AlgD, genes expression were measured by using quantitative real-time PCR. The result of qRT- PCR, summarized in Figures 1 and 2. The clinical P. aeruginosa isolates, showed an increase the fold change in the expression level of pslA gene were (1.2) at pH 9 while decrease the fold change in the expression level of both pelA were (0.01, 0.1) and AlgD genes (0.01, 0.19) at pH (5, 9) respectively, compared to control sample (1.00) at pH 7.

Regarding environmental isolates, the results obtained revealed the expression level of pslA gene increase at pH 9 were (6.2) while, decrease at pH 5 was (0.05), on the other hand decrease in the expression level of both pelA were (0.08, 0.03) and AlgD genes (0.07, 0.03) at pH (5, 9) respectively compared to control sample (1.00) at pH 7.

The findings above showed that pH had a significant impact on the levels of PslA, PelA and AlgD gene expression. Evidently, three genes responded differently to pH 9 in clinical and environmental isolates, with PslA expression upregulated and PelA and AlgD expression levels downregulated. However, Colvin et al. (2012) provided an explanation for these findings by showing that an increase in one gene's expression correlated with a decrease in the expression of the other gene. They claimed that this overlap resulted from compensating for one gene's lack of expression with the other gene's overexpression. Additionally, it suggests that this gene is crucial for the development of biofilm. In other studies, such as Kim, Li, Hwang, and Lee (2020) study, which study the effect of other environmental factors such as temperature found P. aeruginosa exhibits much higher levels of Psl, Pel and alg gene expression at 20 °C, when exopolysaccharide synthesis is also at its greatest while at 25, 30 and 37 °C, lower levels of exopolysaccharide synthesis were seen. As well as, Alva, Sundar, D’Souza, and Premanath (2022) compared the expression of a few biofilm genes, including algD, pslA, pslB, pelA and pelD, in environmental and clinical isolates of P. aeruginosa. Results found that the environmental isolate had a multidrug-resistant strain that expressed more biofilm genes than the clinical isolate did.

In general, exopolysaccharides were found to be most abundant in neutral and alkaline pH in both isolates, whereas they were least abundant at acidic pH. This finding demonstrates unequivocally that pH controls the overall exopolysaccharide synthesis. The transport system of a particular species for regulatory chemicals (e. g. amino acids and sugar) is impacted by the differential in hydrogen content between the interior and exterior of an organism. This gene expression, which is often impacted by these chemicals, reacts to changes in pH. Therefore, lowering pH might result in the creation of carbonic acid and bring the pH to a point where the bacteria's enzymes would have been partially denaturated, which would have resulted in a sharp decline in growth (Thomas, 2019). Finally, by acting as chemical and physical barriers, exopolysaccharides can promote tolerance to antibiotics, immune system and other stimuli (Rossi, Paroni, & Landini, 2018).

Conclusion

In light of the currently available data, both clinical and environmental isolates formed biofilm but with significant difference. There are differences in the expression of genes involve in biofilm synthesis between clinical and environmental isolates, environmental isolates showed the lowest genes expression of pslA, pelA and algD under the influence of changing in pH. Also, acidic pH was favored to inhibit biofilm production. According to findings of this study, environmental isolates of P. aeruginosa are more sensitive to changing of pH may be due to the fact that they lack antibiotic resistance genes.

Figures

Fold change of pslA, pelA and AlgD genes in clinical P. aeruginosa isolates under the influence of changing pH

Figure 1

Fold change of pslA, pelA and AlgD genes in clinical P. aeruginosa isolates under the influence of changing pH

Fold change of pslA, pelA and AlgD genes in environmental P. aeruginosa isolates under the influence of changing pH

Figure 2

Fold change of pslA, pelA and AlgD genes in environmental P. aeruginosa isolates under the influence of changing pH

Program for reverse transcription

Reaction stepTemperature (°C)Time
Reverse transcription421 h
Inactivation8010 min

Sequences of the primers employed in the study

PrimersPrimer sequence (5″→3′)Product sizeReference
pslAFATAAGATCAAGAAACGCGTGGA146 bpColvin et al. (2011)
RTGTAGAGGTCGAACCACACCG
PelAFCCTTCAGCCATCCGTTCTTCT118 bp
RTCGCGTACGAAGTCGACCTT
Alg DFGAGGAATACCAGCTGATCCGG129 bpDesigned in present study
RCACCGAGTTCAAGGACCTGAA
Ps16SrRNAFACCTGGACTGATACTGACACTGA Goldsworthy (2008)
RGTGGACTACCAGGGTATCTAATCCT

Components utilized in qRT-PCR in reaction

ComponentsAmount
Universal qPCR Master Mix10 μL
10 μM of Forward Primer1 μL
10 μM of Reverse Primer1 μL
Template cDNA5 μL
Nuclease-Free Water3 μL
Total volume20 μL

Protocol of qRT-PCR

PhaseTemp of °CTimeCycles
Initial denaturation9560 s1
Denaturation9515 s45
Extension6030 s + plate (read)
Melt curve60–9540 min1

Distribution of clinical and environmental Pseudomonas aeruginosa isolates with their ability to produce biofilm

Clinical isolates of P. aeruginosa (OD490)Environmental isolates of P. aeruginosa (OD490)
Strong biofilmModerate biofilmWeak biofilmNonproduce biofilmStrong biofilmModerate biofilmWeak biofilmNonproduce biofilm
25 (47.2%)13 (24.5%)15 (28.3%)8 (13.11%)13 (31.71)11 (26.83%)17 (41.46)7 (14.58%)

Influence of pH on mean biomass of clinical and environmental P. aeruginosa isolates (Mean ± SE)

Clinical isolates of P. aeruginosaEnvironmental isolates of P. aeruginosaLSD (p-value)
Effect of pH (OD490)Effect of pH (OD490)
Control pH (7)at pH 5at pH 9Control pH (7)at pH 5at pH 9
0.39 ± 0.010.28 ± 0.020.40 ± 0.0070.46 ± 0.030.34 ± 0.010.35 ± 0.010.119 * (0.046)
* (p ≤ 0.05)

Note(s): *significant (p < 0.05)

References

Abd El-Aleam, R. H., George, R. F., Georgey, H. H., & Abdel-Rahman, H. M. (2021). Bacterial virulence factors: A target for heterocyclic compounds to combat bacterial resistance. Royal Society of Chemistry, 11, 3645936482.

Ahmed, I. A., Aljondi, I. A., Alabed, A. A., Al-Mahdi, A. Y., & Abdsalam, R. (2021). Isolation, screening and antibiotic sensitivity of Pseudomonas species from Kelana Jaya lake soil in Selangor Malaysia. Baghdad Science Journal, 18(3), 455461.

Alotaibi, G., & Bukhari, M. (2021). Factors influencing bacterial biofilm formation and development. American Journal of Biomedical Sciences, 12(6). doi: 10.34297/AJBSR.2021.12.001820.

Colvin, K. M., Irie, Y., Tart, C. S., Urbano, R., Whitney, J. C., & Ryder, C. (2012). The Pel and Psl polysaccharides provide Pseudomonas aeruginosa structural redundancy within the biofilm matrix. Environmental Microbiology, 14, 19131928.

Alva, P. P., Sundar, S., D'Souza, C., & Premanath, R. (2022). Increased expression of genes involved in biofilm formation in a multidrug-resistant environmental Pseudomonas aeruginosa isolate. Journal of Datta Meghe Institute of Medical Sciences, 16, 35762.

Bahador, N., Shoja, S., Faridi, F., Dozandeh-Mobarrez, B., Qeshmi, F. L., & Javadpour, S. (2019). Molecular detection of virulence factors and biofilm formation in Pseudomonas aeruginosa obtained from different clinical specimens in Bandar Abbas. The Iranian Journal of Microbiology, 11(1), 2530.

Cho, H. H., Kwon, C. K., Kim, S., Park, Y., & Koo, S. .H. (2018). Association between biofilm formation and antimicrobial resistance in Carbapenem-resistant Pseudomonas aeruginosa. Annals of Clinical and Laboratory Science, 48(3), 363368.

Colvin, K., Gordon, V., Murakami, K., Borlee, B., Wozniak, D., & Wong, G. (2011). The Pel polysaccharide can serve a structural and protective role in the biofilm matrix of Pseudomonas aeruginosa. PLoS Pathogens, 7(1), e1001264. doi: 10.1371/journal.ppat.1001264.

Ell-Amin, A. M., Sulieman, A. I., & El-Khalifa, E. A. (2012). Microbiologicalassessment of drinking water quality in wad-medani and Khartoum states. Sixteenth International Water Technology Conference. IWTC, 6(4), 645649).

Goldsworthy, M. J. (2008). Gene expression of Pseudomonas aeruginosa and MRSA within a catheter-associated urinary tract infection biofilm model. Bioscience Horizons, 1(1), 2837.

Hostacká, A., Ciznár, I., & Stefkovicová, M. (2010). Temperature and pH affect the production of bacterial biofilm. Folia Microbiologica (Praha), 55(1), 7578.

Karami, P., Mohajeri, P., Yousefi, R., & Karami, M. (2019). Molecular characterization of clinical and environmental Pseudomonas aeruginosa isolated in a burn center. Saudi Journal of Biological Sciences, 26(7), 17311736.

Kim, S., Li, X., Hwang, Hj., & Lee, Hj (2020). Thermoregulation of Pseudomonas aeruginosa biofilm formation. Applied and Environmental Microbiology, 86(22), e01584e01520.

Kumar, S., Paliya, B. S., & Singh, B. N. (2022). Superior inhibition of virulence and biofilm formation of Pseudomonas aeruginosa PAO1 by phyto-synthesized silver nanoparticles through anti-quorum sensing activity. Microbial Pathogenesis, 170, 105678. doi: 10.1016/j.micpath.2022.105678.

Lin, Q., Pilewski, J. M., & Di, Y. P. (2021). Cystic fibrosis acidic microenvironment determines antibiotic susceptibility and biofilm formation of Pseudomonas aeruginosa. The Prprint Server for Biology, 12, 115, 747834. doi: 10.1101/2020.10.15.339978.

Livak, K., & Schmittgen, T. (2001). Analysis of relative gene expression data using real-time quantitative PCR and the -2(Delta CT) Method. Methods, 25(4), 402408.

Maurice, N. M., Bedi, B., & Sadikot, R. R. (2018). Pseudomonas aeruginosa biofilms: Host response and clinical implications in lung infections. The American Journal of Respiratory Cell and Molecular Biology, 58(4), 428439.

Obaid, W. A.(2021). Starvation as an Environmental Stress Factor in Mixed and Single Biofilms Pseudomonas aeruginosa and Staphylococcus aureus: A Comparative Study, Ph.D. Thesis. College of Science, University of Baghdad, Iraq.

Rasamiravaka, T., Quentin, L., Pierre, D., & El Jaziri, M. (2015). The Formation of biofilms by Pseudomonas aeruginosa: A review of the natural and synthetic compounds interfering with control mechanisms. BioMed Research International, 2015, 17, Article ID 759348, 2018. doi: 10.1155/2015/759348.

Rossi, E., Paroni, M., & Landini, P. (2018). Biofilm and motility in response to environmental and host-related signals in Gram negative opportunistic pathogens. Journal of Applied Microbiology, 125, 15871602.

Roy, P. K., Ha, A. J., Mizan, F. R., Hossain, I., Ashrafudoulla, M. D., & Toushik, S. H. (2021). Effects of environmental conditions (temperature, pH, and glucose) on biofilm formation of Salmonella enterica serotype Kentucky and virulence gene expression. Poultry Science Journal, 100(7), 113.

Sánchez-Clemente, R., María, I. I., Ana, G. P., María, I. G., Faustino, M., & Rafael, B. (2018). Study of pH changes in media during bacterial growth of several environmental strains. Proceedings (Vol. 2, p. 1297).

SAS (2018). Statistical analysis system, user's guide. Statistical. Version 9 (6th ed.). Cary. N.C. USA: SAS. Inst. Inc.

Singh, B. R., Singh, B. N., Singh, A., Khan, W., Naqvi, A. H., & Singh, H. B. (2015). Mycofabricated biosilver nanoparticles interrupt Pseudomonas aeruginosa quorum sensing systems. Scientific Reports, 5, 13719. doi: 10.1038/srep13719.

Singh, B. N., Singh, B. R., Singh, L., Prakashd, D., Dhakareyd, R., Upadhyayd, G., & Singh, H. B. (2009). Oxidative DNA damage protective activity, antioxidant and anti-quorum sensing potentials of Moringa oleifera. Food and Chemical Toxicology, 47(6), 11091116, Get rights and content. doi: 10.1016/j.fct.2009.01.034.

Singh, B. N., Singh, H. B., Singh, A., Singh, B. R., Mishra, A., & Nautiya, C. S. (2012). Lagerstroemia speciosa fruit extract modulates quorum sensing-controlled virulence factor production and biofilm formation in Pseudomonas aeruginosa. Microbiology, 158, 529538. doi: 10.1099/mic.0.052985-0.

Strempel, N., Neidig, A., Nusser, M., Geffers, R., Vieillard, J., & Lesouhaitier, O. (2013). Human host defense peptide LL-37 stimulates virulence factor production and adaptive resistance in Pseudomonas aeruginosa. PLoS One, 8, e82240. doi: 10.1371/journal.pone.0082240.

Thomas, J. (2019). The impact of pH and atmosphere on the growth and antibiotic resistance of Pseudomonas fluorescens. Available from: https://www.labxchange.org/library/items/lb:LabXchange:372f976d:lx_case_study:1 (accessed 14 August 2022).

Tilahun, A., Haddis, S., Teshale, A., & Hadush, T. (2016). Review on biofilm and microbial adhesion. International Journal of Microbiology Research, 7(3), 6373.

Wu, X., Al Farraj, D. A., Jayarajapazham, R., Alkufeidy, R. M., Ponnuswamy, V., & Alkubaisi, N. A. (2020). Characterization of biofilm formed by multidrug resistant Pseudomonas aeruginosa DC-17 isolated from dental caries. Saudi Journal of Biological Sciences, 27, 29552960.

Yu, Z. Y., Luo, Z., Liu, T., & Lin, J. (2019). Anti bacterial activity of mutant chensinin -1 peptide against multidrug resistant Pseudomonas aeruginosa and it effects on biofilm associated gene expression. Experimental and Therapeutic Medicine, 17(3), 20312038.

Acknowledgements

The cooperation of the medical staff at the Al-Yarmouk hospital in Baghdad is appreciated.

Corresponding author

Ahmed Attalah Hassan Al-Fhdawi can be contacted at: al_fahad_979@yahoo.com

Related articles